Thread overview | |||||||
---|---|---|---|---|---|---|---|
|
January 29, 2013 Strange behaviour with mmfile | ||||
---|---|---|---|---|
| ||||
Dear, Why when i try to read this file: ------------Input file------------------------- $ cat little.fastq @H8:C16L5ACXX:8:1101:1168:2103/1 TCTGAAGGCATGCTGCAATTGTGAATGGCAGAAATGT + ?@@DD>DBDAFDF@4CFGICFHHECHEEBF;E@FFFG @H8:C16L5ACXX:8:1101:1223:2104/1 CTCACTTTTGTACTTTAGACAAGCGCTTTTAGTAGTGCT + @@;DD;?DHFFHFG9FAFCEGFGBFE1EFFGFGGHG9D* @H8:C16L5ACXX:8:1101:1166:2142/1 ATCTGGGAAGACGCCGCCGGGTTCAAATCACCTTGGTCGGCATCGTCGATCCGC + ;=?DDDDD3C??)@:E1CDD)?B?B<99BB8=<8)8.=A88<8)56;9/>2=?? By using mmfile ubyte given do not corresponding to the letter. By example for @ i expect 64 but i got 127 ---------------Result----------------------- $ ./test_mmap little2.fastq 127 69 E 76 L 70 F 2 1 1 0 0 0 0 0 0 0 0 0 2 0 62 > 0 … and that continue Big thanks Note i have try with both ldc and gdc |
January 29, 2013 Re: Strange behaviour with mmfile | ||||
---|---|---|---|---|
| ||||
Posted in reply to bioinfornatics | I missed to show the code $ cat test_mmap.d import std.stdio; import std.mmfile; void main(string[] args ){ MmFile m = new MmFile( args[0] ); foreach( ulong c; 0..m.length ) writeln( m[c], " ", cast(dchar) m[c] ); } |
January 29, 2013 Re: Strange behaviour with mmfile | ||||
---|---|---|---|---|
| ||||
Posted in reply to bioinfornatics | On Tuesday, 29 January 2013 at 00:49:07 UTC, bioinfornatics wrote:
> I missed to show the code
>
> $ cat test_mmap.d
> import std.stdio;
> import std.mmfile;
>
> void main(string[] args ){
> MmFile m = new MmFile( args[0] );
> foreach( ulong c; 0..m.length )
> writeln( m[c], " ", cast(dchar) m[c] );
> }
MmFile m = new MmFile( args[0] ); ?
Didn't you mean args[1] or something?
Because now you are reading your binary file and output is correct, its spits out elf header info.
My guess is your are passing file with DNA (or whatever it is) via command line arguments
|
January 29, 2013 Re: Strange behaviour with mmfile | ||||
---|---|---|---|---|
| ||||
Posted in reply to nazriel | On Tue, Jan 29, 2013 at 05:46:49AM +0100, nazriel wrote: > On Tuesday, 29 January 2013 at 00:49:07 UTC, bioinfornatics wrote: > >I missed to show the code > > > >$ cat test_mmap.d > >import std.stdio; > >import std.mmfile; > > > >void main(string[] args ){ > > MmFile m = new MmFile( args[0] ); > > foreach( ulong c; 0..m.length ) > > writeln( m[c], " ", cast(dchar) m[c] ); > >} > > MmFile m = new MmFile( args[0] ); ? > Didn't you mean args[1] or something? [...] Good catch! I looked at the OP's code and didn't notice that. :) In D, args[0] is the name of the program, and args[1] is the first argument, etc.. T -- Nearly all men can stand adversity, but if you want to test a man's character, give him power. -- Abraham Lincoln |
January 29, 2013 Re: Strange behaviour with mmfile | ||||
---|---|---|---|---|
| ||||
Posted in reply to H. S. Teoh | On Tuesday, 29 January 2013 at 06:37:11 UTC, H. S. Teoh wrote:
> On Tue, Jan 29, 2013 at 05:46:49AM +0100, nazriel wrote:
>> On Tuesday, 29 January 2013 at 00:49:07 UTC, bioinfornatics wrote:
>> >I missed to show the code
>> >
>> >$ cat test_mmap.d
>> >import std.stdio;
>> >import std.mmfile;
>> >
>> >void main(string[] args ){
>> > MmFile m = new MmFile( args[0] );
>> > foreach( ulong c; 0..m.length )
>> > writeln( m[c], " ", cast(dchar) m[c] );
>> >}
>>
>> MmFile m = new MmFile( args[0] ); ?
>> Didn't you mean args[1] or something?
> [...]
>
> Good catch! I looked at the OP's code and didn't notice that. :)
>
> In D, args[0] is the name of the program, and args[1] is the first
> argument, etc..
>
>
> T
Oh yes stupid error thanks
LOL
|
Copyright © 1999-2021 by the D Language Foundation