January 30, 2013 Fastq reader | ||||
---|---|---|---|---|
| ||||
Dear, I have wrote anither fastq reader: http://dpaste.dzfl.pl/2a7885dd --------Example of Fastq File---------------------- @H8:C16L5ACXX:8:1101:1168:2103/1 TCTGAAGGCATGCTGCAATTGTGAATGGCAGAAATGT + ?@@DD>DBDAFDF@4CFGICFHHECHEEBF;E@FFFG @H8:C16L5ACXX:8:1101:1223:2104/1 CTCACTTTTGTACTTTAGACAAGCGCTTTTAGTAGTGCT + @@;DD;?DHFFHFG9FAFCEGFGBFE1EFFGFGGHG9D* @H8:C16L5ACXX:8:1101:1166:2142/1 ATCTGGGAAGACGCCGCCGGGTTCAAA TCACCTTGGTCGGCATCGTCGATCCGC + ;=?DDDDD3C??)@:E1CDD)?B?B<99BB8=<8)8.=A88<8)56;9/>2=?? ------------------------------------------------ A fastq file contains a: - identifier line - sequence line - comment line - quality line when you loop over Fastq with following code it will yied each turn the type ( identifier, sequence, comment, quality ) and the letter As: IDENTIFIER @ IDENTIFIER H IDENTIFIER 8 IDENTIFIER : IDENTIFIER C ... IDENTIFIER / IDENTIFIER 1 SEQUENCE T SEQUENCE C SEQUENCE T SEQUENCE G ... SEQUENCE A SEQUENCE T SEQUENCE G SEQUENCE T COMMENT + QUALITY ? QUALITY @ QUALITY @ ... QUALITY F QUALITY F QUALITY F QUALITY G So I would like by example compute in one pass - number of ACGT in sequence - count number of quality letter with @ This into distinct function as ------------------------------------------------ foreach( state, letter; file.Fastq ){ countBase( state, letter ); countQuality( state, letter, '@' ); } ------------------------------------------------ goal is to be able to add dynamicaly some function while reading file I do not want somethink like ------------------------------------------------ foreach( state, letter; file.Fastq ){ if( state == State.SEQUENCE ) stat[letter]++; if( state == State.QUALITY && letter == '@' ) count++; } ------------------------------------------------ because in this case i can not to write some basics tool I think delegate i do not know if it is the way to go Thanks a lot, I hope my problem is enough clear |
Copyright © 1999-2021 by the D Language Foundation